ID: 983810060_983810063

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 983810060 983810063
Species Human (GRCh38) Human (GRCh38)
Location 4:172050582-172050604 4:172050602-172050624
Sequence CCTTTATCTGAGGTCTATGTGCC GCCAGTGGACCCATTTGGTGTGG
Strand - +
Off-target summary {0: 15, 1: 37, 2: 68, 3: 79, 4: 164} {0: 2, 1: 4, 2: 27, 3: 51, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!