ID: 983811821_983811829

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 983811821 983811829
Species Human (GRCh38) Human (GRCh38)
Location 4:172072051-172072073 4:172072083-172072105
Sequence CCGGGCTCTTTATTGTAGATAAG GGGCAGGTTGCTGCAGATTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 172} {0: 3, 1: 9, 2: 39, 3: 76, 4: 294}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!