ID: 983844932_983844939

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 983844932 983844939
Species Human (GRCh38) Human (GRCh38)
Location 4:172506332-172506354 4:172506365-172506387
Sequence CCCTCCATGATCCTCATAAAAAC TCATTGGAGAGATGGAGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 23, 3: 51, 4: 243} {0: 1, 1: 0, 2: 7, 3: 67, 4: 362}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!