ID: 983892046_983892049

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 983892046 983892049
Species Human (GRCh38) Human (GRCh38)
Location 4:173039731-173039753 4:173039752-173039774
Sequence CCTACATAGTGCCAATACAGCCT CTACAAATTCACATTCCACATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 243} {0: 1, 1: 1, 2: 2, 3: 30, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!