ID: 984022518_984022521

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 984022518 984022521
Species Human (GRCh38) Human (GRCh38)
Location 4:174503221-174503243 4:174503243-174503265
Sequence CCAGCACTAAGCAGGAAGGGTGG GCTCCCATACTCATGGCAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 142} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!