ID: 984168453_984168455

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 984168453 984168455
Species Human (GRCh38) Human (GRCh38)
Location 4:176332221-176332243 4:176332255-176332277
Sequence CCAATAAATATTGATGAAGAATG TTTCTAATGTGACCAAACCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 37, 4: 352} {0: 1, 1: 0, 2: 0, 3: 21, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!