ID: 984646948_984646952

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 984646948 984646952
Species Human (GRCh38) Human (GRCh38)
Location 4:182230868-182230890 4:182230885-182230907
Sequence CCTCCTGTTCTCCGATAATTACA ATTACAGCACACGAAGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 79} {0: 1, 1: 0, 2: 0, 3: 9, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!