ID: 984647869_984647871

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 984647869 984647871
Species Human (GRCh38) Human (GRCh38)
Location 4:182238852-182238874 4:182238897-182238919
Sequence CCTACCGCGGTGACTCATTCATA AAACAAGCAAGAGAAAACAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 127, 4: 1289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!