ID: 984677615_984677620

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 984677615 984677620
Species Human (GRCh38) Human (GRCh38)
Location 4:182568327-182568349 4:182568374-182568396
Sequence CCTGCAGAAGAGAGGGAATAATT TTGGAGAAACAGAATGAGAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 77, 4: 796}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!