ID: 984830238_984830247

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 984830238 984830247
Species Human (GRCh38) Human (GRCh38)
Location 4:183966132-183966154 4:183966175-183966197
Sequence CCAGGGAGGGAGTTTTGACCCCT GTGGTTATGCCTGAGACGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 153} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!