ID: 984916864_984916881

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 984916864 984916881
Species Human (GRCh38) Human (GRCh38)
Location 4:184733256-184733278 4:184733308-184733330
Sequence CCTGCTCCAGCTTTTCCACCCTA AGGCAGCCTTCCCAGGCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 244} {0: 1, 1: 0, 2: 3, 3: 33, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!