ID: 984928172_984928179

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 984928172 984928179
Species Human (GRCh38) Human (GRCh38)
Location 4:184825312-184825334 4:184825353-184825375
Sequence CCACGGCCAAGTGCAAGGGCCAC ACCGAGAGAATGTCTGCCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 102} {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!