ID: 984971194_984971197

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 984971194 984971197
Species Human (GRCh38) Human (GRCh38)
Location 4:185192701-185192723 4:185192743-185192765
Sequence CCTTTGACCTTCTTAAGATCAGA TTTTTTTTTTTTTTTTGAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 189} {0: 83672, 1: 60776, 2: 74199, 3: 114646, 4: 163091}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!