ID: 984973525_984973533

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 984973525 984973533
Species Human (GRCh38) Human (GRCh38)
Location 4:185210263-185210285 4:185210285-185210307
Sequence CCCGACTCCTGGCCGCCCAGCTC CCGCCGGCCCTCCCCGCTTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 375} {0: 1, 1: 0, 2: 2, 3: 18, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!