ID: 984978862_984978867

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 984978862 984978867
Species Human (GRCh38) Human (GRCh38)
Location 4:185258055-185258077 4:185258082-185258104
Sequence CCATTCCCACTAGGACTGAGGCA ACCTTAGGACAGAAAAAATTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 22, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!