ID: 984989713_984989721

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 984989713 984989721
Species Human (GRCh38) Human (GRCh38)
Location 4:185368393-185368415 4:185368434-185368456
Sequence CCATAACACACTGCCTGCCATGG CCCAACCTGTTCCCTTCCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 237} {0: 1, 1: 1, 2: 2, 3: 27, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!