ID: 985004855_985004865

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 985004855 985004865
Species Human (GRCh38) Human (GRCh38)
Location 4:185524080-185524102 4:185524125-185524147
Sequence CCTAGACCTCCCTACTTCCCTCC AAGACAGTGAGTGATCTGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 17, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!