ID: 985104915_985104919

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 985104915 985104919
Species Human (GRCh38) Human (GRCh38)
Location 4:186490707-186490729 4:186490757-186490779
Sequence CCCCCTAACAAAAGACTGATTAG ACGAAAGTTTTACATGACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 285} {0: 1, 1: 0, 2: 3, 3: 31, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!