ID: 985108524_985108529

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 985108524 985108529
Species Human (GRCh38) Human (GRCh38)
Location 4:186522891-186522913 4:186522916-186522938
Sequence CCGTTTTTTTTCTCTCATTTGTA CAGGAAAAAGACTGGGTAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 39, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!