ID: 985127803_985127808

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 985127803 985127808
Species Human (GRCh38) Human (GRCh38)
Location 4:186712785-186712807 4:186712829-186712851
Sequence CCTCATCACCCAGCTGTGATGAC ACATTGCCAAACACCCTCTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 240} {0: 1, 1: 0, 2: 4, 3: 52, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!