ID: 985136693_985136695

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 985136693 985136695
Species Human (GRCh38) Human (GRCh38)
Location 4:186793263-186793285 4:186793315-186793337
Sequence CCTGCTGGTCTCTTACCACAGAA TTACCGAGCTAAGCTTAAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 173} {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!