ID: 985153962_985153965

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 985153962 985153965
Species Human (GRCh38) Human (GRCh38)
Location 4:186969369-186969391 4:186969385-186969407
Sequence CCATTTCACATGAAGAGGCAGGC GGCAGGCGACATGGGAGTGCTGG
Strand - +
Off-target summary {0: 104, 1: 4, 2: 1, 3: 17, 4: 213} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!