ID: 985153962_985153965 |
View in Genome Browser |
Spacer: -7 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 985153962 | 985153965 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 4:186969369-186969391 | 4:186969385-186969407 |
Sequence | CCATTTCACATGAAGAGGCAGGC | GGCAGGCGACATGGGAGTGCTGG |
Strand | - | + |
Off-target summary | {0: 104, 1: 4, 2: 1, 3: 17, 4: 213} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |