ID: 985487301_985487316

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 985487301 985487316
Species Human (GRCh38) Human (GRCh38)
Location 5:158679-158701 5:158724-158746
Sequence CCTTCCTCCCTCTGCCTGTCCTG TCCTCGTTCTACTCCTTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 15, 3: 146, 4: 1248} {0: 1, 1: 1, 2: 1, 3: 24, 4: 193}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!