ID: 985509249_985509258

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 985509249 985509258
Species Human (GRCh38) Human (GRCh38)
Location 5:302939-302961 5:302966-302988
Sequence CCCTGCATAACTGCTGGAGGGCG CTTCCCAAGGGGAAGTTGGGAGG
Strand - +
Off-target summary {0: 10, 1: 5, 2: 2, 3: 5, 4: 74} {0: 2, 1: 0, 2: 2, 3: 17, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!