ID: 985515209_985515214

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 985515209 985515214
Species Human (GRCh38) Human (GRCh38)
Location 5:340143-340165 5:340161-340183
Sequence CCAGTGAAACCATTTAGACCTGG CCTGGGTTTTTTGATGTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 45, 3: 197, 4: 709} {0: 1, 1: 2, 2: 10, 3: 55, 4: 376}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!