ID: 985572059_985572062

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 985572059 985572062
Species Human (GRCh38) Human (GRCh38)
Location 5:652182-652204 5:652195-652217
Sequence CCTTGAGCACTGTGGCCTGGATG GGCCTGGATGTGGACAAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 33, 4: 314} {0: 1, 1: 0, 2: 3, 3: 26, 4: 285}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!