ID: 985574835_985574844

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 985574835 985574844
Species Human (GRCh38) Human (GRCh38)
Location 5:669259-669281 5:669281-669303
Sequence CCCCCAGGGGGCGCTGGTGAGCC CCGGTGAGCCGGAGGTGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 39, 4: 336} {0: 1, 1: 0, 2: 0, 3: 9, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!