ID: 985577495_985577499

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 985577495 985577499
Species Human (GRCh38) Human (GRCh38)
Location 5:680290-680312 5:680328-680350
Sequence CCGGATCTACTGAAGACAGACAC TGAGGAAAAATGCTTCAGGCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 22, 4: 145} {0: 1, 1: 1, 2: 4, 3: 19, 4: 272}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!