ID: 985580743_985580754

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 985580743 985580754
Species Human (GRCh38) Human (GRCh38)
Location 5:694010-694032 5:694059-694081
Sequence CCCTTCACGCAGGAGTGGAGGAG TCAGCTTCCGTTCTCCCTGCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 6, 4: 160} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!