ID: 985584806_985584814

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 985584806 985584814
Species Human (GRCh38) Human (GRCh38)
Location 5:725174-725196 5:725201-725223
Sequence CCTGCCTTGTGAGGACAAGCAGA GCCATCGGAGAACCAGGAAGGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 20, 4: 177} {0: 1, 1: 2, 2: 15, 3: 145, 4: 519}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!