ID: 985598309_985598317

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 985598309 985598317
Species Human (GRCh38) Human (GRCh38)
Location 5:809488-809510 5:809515-809537
Sequence CCTGCCTTGTGAGGACAAGCAGA GCCATCGGAGAACCCGGAAGGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 2, 3: 20, 4: 177} {0: 1, 1: 1, 2: 4, 3: 20, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!