ID: 985606779_985606793

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 985606779 985606793
Species Human (GRCh38) Human (GRCh38)
Location 5:862154-862176 5:862199-862221
Sequence CCCTCTAAGTCCTGCAGGATCAG TGCGCAGCCCAAGGGGCAGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 26, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!