ID: 985608427_985608433

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 985608427 985608433
Species Human (GRCh38) Human (GRCh38)
Location 5:871938-871960 5:871965-871987
Sequence CCACCTGGAATATGACCAGTTGC GACCAGCTCGAGTCCTGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 93} {0: 1, 1: 0, 2: 0, 3: 6, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!