ID: 985620422_985620435

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 985620422 985620435
Species Human (GRCh38) Human (GRCh38)
Location 5:952145-952167 5:952176-952198
Sequence CCCTGACCCCTGGGTGGGCTCAT GGGAGAGCTGGCGGCAGGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 53, 4: 508}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!