ID: 985674578_985674586

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 985674578 985674586
Species Human (GRCh38) Human (GRCh38)
Location 5:1224464-1224486 5:1224477-1224499
Sequence CCAGCTCCTGCCTCCTCCTGGGG CCTCCTGGGGGGTCTGGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 139, 4: 876} {0: 1, 1: 0, 2: 1, 3: 28, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!