ID: 985677713_985677720

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 985677713 985677720
Species Human (GRCh38) Human (GRCh38)
Location 5:1240814-1240836 5:1240851-1240873
Sequence CCCAAAACTTCAGAATGTGACCT CTTTGCAGATGTAATTAAGTAGG
Strand - +
Off-target summary {0: 2, 1: 18, 2: 172, 3: 705, 4: 1509} {0: 2, 1: 9, 2: 28, 3: 67, 4: 258}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!