ID: 985678194_985678206

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 985678194 985678206
Species Human (GRCh38) Human (GRCh38)
Location 5:1243064-1243086 5:1243105-1243127
Sequence CCAGCAGACGCTGCACCCAGCAG CCCGAGAGAGTGGGCATTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 271} {0: 1, 1: 0, 2: 0, 3: 6, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!