ID: 985710156_985710168

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 985710156 985710168
Species Human (GRCh38) Human (GRCh38)
Location 5:1423352-1423374 5:1423393-1423415
Sequence CCACGCTGCTGGGTACCCACTGC AGGGTCCCTCTCCAGGGATGAGG
Strand - +
Off-target summary {0: 4, 1: 3, 2: 7, 3: 14, 4: 142} {0: 1, 1: 0, 2: 0, 3: 22, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!