ID: 985730707_985730716

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 985730707 985730716
Species Human (GRCh38) Human (GRCh38)
Location 5:1546719-1546741 5:1546750-1546772
Sequence CCTTCCATCCTCTGCAAAGCAGG GGAACTTACCTGTAGGACCGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 33}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!