ID: 985895923_985895925

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 985895923 985895925
Species Human (GRCh38) Human (GRCh38)
Location 5:2750102-2750124 5:2750129-2750151
Sequence CCACAGGTAGCTCTTTGATATCT TTCTGCAGATGCTTGGAGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148} {0: 1, 1: 0, 2: 0, 3: 26, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!