ID: 986169825_986169827

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 986169825 986169827
Species Human (GRCh38) Human (GRCh38)
Location 5:5306589-5306611 5:5306611-5306633
Sequence CCTCAAAGAAGTGCTCACATTTG GCCGAAGCCCAGCCTGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 229} {0: 1, 1: 0, 2: 2, 3: 32, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!