ID: 986339869_986339880

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 986339869 986339880
Species Human (GRCh38) Human (GRCh38)
Location 5:6779788-6779810 5:6779837-6779859
Sequence CCAAGTATTGCCAGCCATCACCA TTCCCACTAGAGCCCCCAAAAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 19, 3: 103, 4: 353} {0: 1, 1: 0, 2: 0, 3: 33, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!