ID: 986451554_986451562

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 986451554 986451562
Species Human (GRCh38) Human (GRCh38)
Location 5:7869725-7869747 5:7869760-7869782
Sequence CCGGATTGTGGGGCAGTAGCAGG ATTGATCCTGGGAAGCCCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 180} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!