ID: 986505479_986505480

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 986505479 986505480
Species Human (GRCh38) Human (GRCh38)
Location 5:8445651-8445673 5:8445677-8445699
Sequence CCATATACAGAAGAAGAGTAAAT AAAACACTTTCTTGAACAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 316} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!