ID: 986561022_986561031

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 986561022 986561031
Species Human (GRCh38) Human (GRCh38)
Location 5:9061023-9061045 5:9061070-9061092
Sequence CCAGCTTAAGGGCAGCCTGCTTG GGTGAAATCCACCAAGGGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!