ID: 986585231_986585240

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 986585231 986585240
Species Human (GRCh38) Human (GRCh38)
Location 5:9309512-9309534 5:9309559-9309581
Sequence CCTTTGCATGATCCTCCACTCGA CTGGAGGCATGGATTGAAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 88} {0: 1, 1: 0, 2: 2, 3: 27, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!