ID: 986617884_986617898

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 986617884 986617898
Species Human (GRCh38) Human (GRCh38)
Location 5:9638777-9638799 5:9638818-9638840
Sequence CCTTGAGTGGGGCTTGCCACAGC TGGTGGTTCTCAGGCCAATGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 56, 4: 248} {0: 2, 1: 19, 2: 25, 3: 56, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!