ID: 986707429_986707440

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 986707429 986707440
Species Human (GRCh38) Human (GRCh38)
Location 5:10463518-10463540 5:10463544-10463566
Sequence CCTCCAGGCTCCAGCCCCAAGGG TGGGGTCCCTGAGGTCTTCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 60, 4: 549} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!