ID: 986742917_986742920

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 986742917 986742920
Species Human (GRCh38) Human (GRCh38)
Location 5:10719480-10719502 5:10719514-10719536
Sequence CCATCTTCTGCAGATAACTACTC GACAGCTCTTGGCCTGTTACTGG
Strand - +
Off-target summary {0: 178, 1: 192, 2: 102, 3: 110, 4: 247} {0: 162, 1: 189, 2: 129, 3: 114, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!