ID: 986830568_986830575

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 986830568 986830575
Species Human (GRCh38) Human (GRCh38)
Location 5:11572589-11572611 5:11572627-11572649
Sequence CCACTTCAACTTCTTCCCTCCTC CCACTAGCTAATATACCCACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 97, 4: 932} {0: 1, 1: 0, 2: 1, 3: 5, 4: 54}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!